Seudónimo Seudónimo

29-03-2017
Chemistry

contestada

The figure below represents ____

A) Photovoltaic cell
B) Greenhouse Effect
C) Use of Hydroelectric Power
D) Use of Nuclear Energy

The figure below represents A Photovoltaic cell B Greenhouse Effect C Use of Hydroelectric Power D Use of Nuclear Energy class=

Respuesta :

MohammadHaisam MohammadHaisam

29-03-2017

B is the answer bro bcz greenhouse effect traps most of the heat and allows a little of it to escape..

Answer Link

fuzzyjo13 fuzzyjo13

29-03-2017

B) A greenhouse effect

Answer Link

Otras preguntas

Applying: Given the following DNA sequence from the template strand of a given gene: 5'CTTGCGTCACCTGAGACCTGGCATCG3' a) Write the mRNA that will be transcribed f

We are again studying the times required to solve two elementary math problems. Suppose we ask four students to attempt both Problem A and Problem B. Assume the

Complete (predict the products, write correct formulas) and balance the following reaction: Gaseous hydrochloric acid reacts with solid calcium hydroxide. Incl

Professional service organizations include __________.

Determine the grams of sodium chloride produced when 10 g of sodium react with 10 grams chlorine gas according to the equation 2Na + Cl2 = 2 NaCl

You are going to purchase (2) items from an online store. If you spend $100 or more, you will get a 10% discount on your total purchase. If you spend between $5

According to the article, how prepared were the Cherokee for the journey west? They had been issued boots and clothing suitable for the weather. They had wagons

One advantage of ______ is the direct crossing of trades without using a broker-dealer system eliminates the bid-ask spread that otherwise would be incurred. Mu

Pls help me with my work

In triangle JKL, angle JKL is a right angle, KM and is an altitude. JL=8 and JM=2, find JK