30-11-2020
Biology

contestada

Help I'm confused!
This is the beginning sequence of the first exon in the mRNA sequence:

AUGAAGCUCUUUUGGUUGCUUUUCACCAUU

Give the DNA/genomic sequence it was transcribed from.

Respuesta :

30-11-2020

Answer:

TACTTCGAGAAAACCAACGAAAAGTGGTAA

Explanation:

Transcription is the process by which a strand of DNA is copied into mRNA.

Remember that in mRNA, U (Uracil) bonds with A (Adenine).

Hope that helps.

Answer Link

Otras preguntas

plz helppre-algebra18 – x = 12

A discount bond will have a negative nominal interest rate when the: A. current bond yield is smaller than its yield to maturity. B. sum of the annual coupon p

Write each expression in exponential from 5 x 5 x 5 x 5 x 5 =

Over the course of a year, a tractor trailer commutes 160,000 miles across America. a. Assuming a trucker changes his tires every 40,000 miles, and that he star

Select the correct answer. What was one major reason for the conflict between Rome and Carthage? A. Both powers wanted control over the Mediterranean Sea. B.

pdf Suppose that the pound is pegged to gold at £20 per ounce and the dollar is pegged to gold at $35 per ounce. This implies an exchange rate of $1.75 per poun

Historically, which combination of characteristics have most presidents of the U.S. shared? Question 14 options: self-educated, from states with large Protestan

A copy company wants to expand production. It currently has 20 workers who share eight copiers. Two months ago, the firm added two copiers, and output increased

what is the 1.20.010 law

Which aspect of the financial system created by the Commercial Revolution most clearly paved the way for today’s corporations?