31-01-2020
Mathematics

contestada

11) f(x) = -x + 4x3 – 2x + 2

Respuesta :

Itsjoshgacha Itsjoshgacha

31-01-2020

Answer:

Step-by-step explanation:

Ver imagen Itsjoshgacha

Answer Link

Otras preguntas

Two automobiles left simultaneously from cities A and B heading towards each other and met in 5 hours. The speed of the automobile that left city A was 10 km/ho

What are some examples of ‘Infrastructure" that you would find in the US and Canada (name 3 or 4)

Read the following claim and counterclaim from an essay: CLAIM: A plant-based diet is best for extending one's life. COUNTERCLAIM: The American Heart Associat

What separates mars from Jupiter?A. SunB. Milky Way GalaxyC. Asteroid Belt D. Black Hole

HELP PLX 46 POINTS! The diameter of the semicircle with center O, shown below, is 4 units. What is the area of the shaded region?

Gravity is an example of an "at a distance" force. Describe how the between gravitational force between any two objects is affected by the distance between them

A carnot heat engine receives 600 kj of heat from a source of unknown temperature and rejects 175 kj of it to a sink at 20°c. determine (a) the temperature of t

Plz help me !!!!!!!!!!

What are the main beliefs of Confucianism?

what is the mrna of tacgggcctatacgctactactggatc