mattie3587 mattie3587

30-11-2022
Business

contestada

an mlo has a borrower come in who is a veteran, the borrower is looking to obtain a va loan. the borrower has never received a va loan before and intends to put 0% down, what would be this borrower's funding fee?

Respuesta :

Otras preguntas

Are there less than 1 million,exactly 1 million or greater than 1 million milligrams in 1 kilogram?

Why are dashes rather than parentheses or commas used in this sentence

Jeff is a financial advisor. he belongs to two different organizations for financial advisors, and he likes to go to their annual meetings. the financial organi

I Dont Understand How To Do This

Brian and Carlos are sharing a large sub sandwich. Brian ate 2 / 5 of the sandwich, and Carlos ate 1 / 5 of the sandwich. How much of the sandwich is left over?

Plz help me!!!!!!!!!!!

Keesha did an experiment to study the rate of photosynthesis in the water plant Elodea. She placed a piece of Elodea in a beaker of water and set the beaker 10

what is the mrna of tacgggcctatacgctactactggatc

Observations about "youth gone wild" have lead to recent calls to reduce the age of responsibility to allow for younger violent criminals to be tried as adults

What is the least common multiple of 14 and 4