samistamper2001 samistamper2001
  • 29-10-2022
  • Biology
contestada

Change any nucleotide between the Reading Frame (Between 'Start' and 'STOP'
transcribing


5’ acgatgcattgtcccgcactgtaatat3’

3’ tgctacgtaacagggcgtgactgcattata5’

Respuesta :

Otras preguntas

how does teamwork help in developing a quality outcome?
What would happen if the food chain was broken?
The sum of three consecutive odd consecutive odd integers is 117117. Find the integers
a collection of specialized cells and cell products that perform a specific function
What was the Safavid empire known for? a. The inhabitants of the empire experienced cultural and religious toleration. b. The empire had a carefully organized
What does a negative moment of inertia mean?
Where does the Krebs cycle occur? Cytoplasm Mitochondrion Cell membrane Nucleus
Which of the following do meteorologists not typically use weather balloons to record? A atmospheric pressure b cloud types c humidity d temperature
write the addition sentence illustrated by each figure
Kiki wants to rent a bounce house for her daughter's party. The cost, y, to rent a bounce house for a number of hours, x, is shown in the table. The initial set