sk0622719 sk0622719
  • 28-09-2022
  • Mathematics
contestada

What do the slope of a line that is perpendicular to the line y=-1/4 x-1?

What do the slope of a line that is perpendicular to the line y14 x1 class=

Respuesta :

Otras preguntas

What business practice contributed most to Andrew Carnegie’s ability to form a monopoly? a) using profits to support charities in order to greatly improving h
How does the body heal itself ?
What is the mRNA sequence to match the DNA sequence below: TACGCTCCATATCGCTAATCGCCGGATCAGATT
Knowing Montressor's intentions towards Fortunato as we read "The Cask of Amontillado" provides the story with what literary element?
Air masses that originate in the Gulf of Mexico are
How many solutions does the equation −4y + 4y + 2 = 2 have? Two Zero One Infinitely many
True or false. A change of color is a sign that a chemical reaction is taking place.
The scientific name for water spider
The number of _______ in an atom of an element is the element's atomic number
What does the saying "the Texas Western Miners would score a victory for equality" mean?